90
|
Promega
pgem-t vitro transcription vector Pgem T Vitro Transcription Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgem-t+vectors/pgem+t+vitro+transcription+vector/10__1128_slash_jvi__75__21__10281___10289__2001-79-10-15 Average 90 stars, based on 1 article reviews
pgem-t vitro transcription vector - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Promega
bluescript pgem-t vector Bluescript Pgem T Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgem-t+vectors/bluescript+pgem+t+vector/10__1128_slash_aem__70__3__1787___1794__2004-119-9-12 Average 90 stars, based on 1 article reviews
bluescript pgem-t vector - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Promega
pgem-t easy vector Pgem T Easy Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgem-t+vectors/pgem+t+easy+vector/10__1074_slash_jbc__m109535200-48-185-189 Average 90 stars, based on 1 article reviews
pgem-t easy vector - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Promega
recombinant pgem t-vectors Recombinant Pgem T Vectors, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgem-t+vectors/recombinant+pgem+t+vectors/pm16461921-67-29-32 Average 90 stars, based on 1 article reviews
recombinant pgem t-vectors - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Promega
pgemt easy cloning vector Pgemt Easy Cloning Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgem-t+vectors/pgemt+easy+cloning+vector/pmc05427257-547-7-11 Average 90 stars, based on 1 article reviews
pgemt easy cloning vector - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Promega
pgem-t easy ta cloning vector; ampr Pgem T Easy Ta Cloning Vector; Ampr, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgem-t+vectors/pgem+t+easy+high+copy+ta+cloning+vector++ampr/10__1128_slash_aem__00642___07-98-57-58 Average 90 stars, based on 1 article reviews
pgem-t easy ta cloning vector; ampr - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Promega
recombinant dna reagent pgem-t easy Recombinant Dna Reagent Pgem T Easy, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgem-t+vectors/recombinant+pgem+t+vector/10__7554_slash_elife__31677-176-0-5 Average 90 stars, based on 1 article reviews
recombinant dna reagent pgem-t easy - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Promega
pgem-t vector manual ![]() Pgem T Vector Manual, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgem-t+vectors/pgem+t+vector+manual/pmc05023260-20-10-9 Average 90 stars, based on 1 article reviews
pgem-t vector manual - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Promega
pgem -t easy-shuttle vector ![]() Pgem T Easy Shuttle Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgem-t+vectors/pgem+t+easy+shuttle+vector/pm23672494-74-8-14 Average 90 stars, based on 1 article reviews
pgem -t easy-shuttle vector - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Promega
pgem®-t basic vector ![]() Pgem® T Basic Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgem-t+vectors/pgem++t+basic+vector/pmc04595440-70-8-11 Average 90 stars, based on 1 article reviews
pgem®-t basic vector - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Promega
sequencing vector pgemt easy ![]() Sequencing Vector Pgemt Easy, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgem-t+vectors/sequencing+vector+pgemt+easy/pmc03416813-152-8-12 Average 90 stars, based on 1 article reviews
sequencing vector pgemt easy - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Promega
pgem-t easy 181 vector ![]() Pgem T Easy 181 Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgem-t+vectors/pgem+t+easy+181+vector/pm29524803-83-10-14 Average 90 stars, based on 1 article reviews
pgem-t easy 181 vector - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Microorganisms
Article Title: Sulfur Oxygenase Reductase (Sor) in the Moderately Thermoacidophilic Leaching Bacteria: Studies in Sulfobacillus thermosulfidooxidans and Acidithiobacillus caldus
doi: 10.3390/microorganisms3040707
Figure Lengend Snippet: Polymerase chain reaction (PCR) primers used in this study.
Article Snippet: T7 , taatacgactcactataggg , Promoterregions , 158 bp ,
Techniques: Polymerase Chain Reaction, Sequencing, Amplification, Plasmid Preparation